SubtiBank SubtiBank
ptsH [2019-02-08 18:07:07]
You are currently viewing an outdated version of SubtiWiki. Please use the newest version!

ptsH [2019-02-08 18:07:07]

HPr, General component of the sugar phosphotransferase system (PTS)
Locus
BSU13900
Isoelectric point
4.58
Molecular weight
9.05 kDa
Protein length
88 aa Sequence Blast
Gene length
267 bp Sequence Blast
Function
PTS-dependent sugar transport and carbon catabolite repression
Product
histidine-containing phosphocarrier protein HPr of the PTS
Essential
no
E.C.
2.7.11.-
Synonyms
HPr
Outlinks
KEGGBsubCycSubtiListUniProtExpression Browser

Genomic Context

      
Loading

Categories containing this gene/protein

  • Cellular processes → Transporters → Phosphotransferase system → General PTS proteins
  • Information processing → Regulation of gene expression → Transcription factors and their control → Control of transcription factor (other than two-component system)
  • Groups of genes → Phosphoproteins → Phosphorylation on a His residue
  • Groups of genes → Phosphoproteins → Phosphorylation on a Ser residue

    • Gene

    Coordinates
    1,459,384 1,459,650

    The protein

    Catalyzed reaction/ biological activity

  • Protein HPr N(pi)-phospho-L-histidine + protein EIIA = protein HPr + protein EIIA N(tau)-phospho-L-histidine (according to Swiss-Prot)

    • Protein family

  • HPr domain (according to Swiss-Prot) HPr family

    • Paralogous protein(s)

  • Crh

    • Domains

  • HPr Domain (288)

    • Modification

  • transient phosphorylation by Enzyme I of the PTS on His-15
  • regulatory phosphorylation on Ser-46 by HprK PubMed
  • an extensive study on in vivo HPr phosphorylation can be found in Singh et al. (2008) PubMed
  • weak phosphorylation on Ser-12 PubMed
  • in vitro phosphorylated by PrkC on Ser-12 PubMed

    • Structure

  • 2HID (NMR) PubMed
  • 1KKM (complex of L. casei HprK with B. subtilis HPr-Ser-P)
  • 1KKL (complex of Lactobacillus casei HprK with B. subtilis HPr)
  • 3OQM (complex of B. subtilis CcpA with P-Ser-HPr and the ackA operator site)
  • 3OQN (complex of B. subtilis CcpA with P-Ser-HPr and the gntR operator site)
  • 3OQO (complex of B. subtilis CcpA with P-Ser-HPr and a optimal synthetic operator site)

    • Localization

  • cytoplasm PubMed

    • Additional information

  • belongs to the 100 most abundant proteins PubMed

    • Expression and Regulation

    Operons

    Genes
    ptsH-ptsI
    Description
    PubMed

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon
    • view in new tab

    Genes
    ptsG-ptsH-ptsI
    Description
    PubMed

    Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

    • Regulatory mechanism

  • stringent response: negative regulation, in stringent response
  • GlcT: antitermination, via the GlcT-dependent RNA switch PubMed, in GlcT regulon

    • Regulation

  • expression activated by glucose (2 fold) (GlcT) PubMed
    • view in new tab

    Biological materials

    Mutant

  • available in Jrg Stlke's lab:
  • MZ303 (cat)
  • GP507 ptsH1 (S46A)
  • GP506 (ptsH-H15A)
  • GP778 (glcT-ptsG-ptsH-ptsI::spc) PubMed
  • BKE13900 (ptsH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT
  • BKK13900 (ptsH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATAAGAATTGACCTCCTCT, downstream forward: _UP4_TAAGGGTGTTAGTACGCCGT

    • Expression vectors

  • pGP438 (with N-terminal Strep-tag, in pGP172), available in Jrg Stlke's lab
  • pAG2 (His-tag) PubMed, available in Anne Galinier lab
  • pGP371(expression / purification of HPr-S46A, with His-tag from E. coli, in pWH844), available in Jrg Stlke's lab
  • pGP1415 (HPr, expression in B. subtilis, from pBQ200), available in Jrg Stlke's lab
  • pGP961 (HPr, expression in B. subtilis with N-terminal Strep-tag, for SPINE, available in Jrg Stlke's lab
  • pGP1416 (HPr-H15A, expression in B. subtilis, from pBQ200), available in Jrg Stlke's lab
  • pGP2431 (N-terminal Strep-tag, expression and purification from B. subtilis, in pGP380), for SPINE, available in Jrg Stlke's lab

    • Two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab

    • Antibody

  • available in Jrg Stlke's lab

    • Labs working on this gene/protein

  • Josef Deutscher, Paris-Grignon, France
  • Jrg Stlke, University of Gttingen, Germany Homepage
  • Richard Brennan, Houston, Texas, USA Homepage
  • Boris Grke, University of Gttingen, Germany Homepage
  • Anne Galinier, University of Marseille, France

    • References

    Loading